ID: 1006812375_1006812381

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1006812375 1006812381
Species Human (GRCh38) Human (GRCh38)
Location 6:36828161-36828183 6:36828205-36828227
Sequence CCATCTGGGGGAGCTTAAGAAAG AGCTACTCGGGACTCCAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140} {0: 1, 1: 1, 2: 68, 3: 1120, 4: 12366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!