ID: 1006818917_1006818922

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1006818917 1006818922
Species Human (GRCh38) Human (GRCh38)
Location 6:36874856-36874878 6:36874869-36874891
Sequence CCGGTCCGTTCAACCCTTTCGAT CCCTTTCGATACCAGGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!