ID: 1006819790_1006819795

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1006819790 1006819795
Species Human (GRCh38) Human (GRCh38)
Location 6:36883716-36883738 6:36883758-36883780
Sequence CCTTCACTCTTCTAGAAAGACAT TCCATGGTTTAGAATAAAAGAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 33, 3: 68, 4: 295} {0: 17, 1: 21, 2: 24, 3: 47, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!