|
Left Crispr |
Right Crispr |
Crispr ID |
1006819790 |
1006819795 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:36883716-36883738
|
6:36883758-36883780
|
Sequence |
CCTTCACTCTTCTAGAAAGACAT |
TCCATGGTTTAGAATAAAAGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 18, 2: 33, 3: 68, 4: 295} |
{0: 17, 1: 21, 2: 24, 3: 47, 4: 248} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|