ID: 1006857853_1006857863

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1006857853 1006857863
Species Human (GRCh38) Human (GRCh38)
Location 6:37148189-37148211 6:37148208-37148230
Sequence CCCACTCCCCTTCTCAAATGGGG GGGGGTAAAATGTTGGAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 37, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!