ID: 1006874036_1006874040

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006874036 1006874040
Species Human (GRCh38) Human (GRCh38)
Location 6:37279879-37279901 6:37279910-37279932
Sequence CCCTGTGGTGGAGTCCACAACTT TGATTGCTTCACATTGCTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 27, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!