ID: 1006878280_1006878285

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1006878280 1006878285
Species Human (GRCh38) Human (GRCh38)
Location 6:37317157-37317179 6:37317192-37317214
Sequence CCTTCTTGATCAAGTGGAGGAAA GAGGAGGATTTTCAGGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 367, 4: 1022} {0: 1, 1: 1, 2: 2, 3: 33, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!