ID: 1006913427_1006913440

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1006913427 1006913440
Species Human (GRCh38) Human (GRCh38)
Location 6:37578991-37579013 6:37579040-37579062
Sequence CCAGATTACTCCACTGTCCCTGT CATCCTACCTCCCTGGGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!