ID: 1006923431_1006923438

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1006923431 1006923438
Species Human (GRCh38) Human (GRCh38)
Location 6:37640863-37640885 6:37640887-37640909
Sequence CCGTTCCTTTGGGGCTGGTGAGG TCCTGGAAGACACTGGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 286} {0: 1, 1: 0, 2: 1, 3: 38, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!