ID: 1006929566_1006929568

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1006929566 1006929568
Species Human (GRCh38) Human (GRCh38)
Location 6:37679613-37679635 6:37679628-37679650
Sequence CCTGGTGGCAGCCTCTGTGCCTC TGTGCCTCAGCCAGTGACAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 29, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!