ID: 1006933112_1006933119

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1006933112 1006933119
Species Human (GRCh38) Human (GRCh38)
Location 6:37699098-37699120 6:37699120-37699142
Sequence CCCAAACGCCCGCGGGGAGGGGC CGTAGGCTGGCAAGCGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!