ID: 1006968384_1006968390

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006968384 1006968390
Species Human (GRCh38) Human (GRCh38)
Location 6:38013747-38013769 6:38013778-38013800
Sequence CCTCCAATGTCCAGGTTACACCT TGGAATCAAAGTATTTGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102} {0: 1, 1: 0, 2: 2, 3: 29, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!