ID: 1006973919_1006973923

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1006973919 1006973923
Species Human (GRCh38) Human (GRCh38)
Location 6:38078703-38078725 6:38078752-38078774
Sequence CCAACCTCAGTCCCGGTCAACAC TAGAACCCACAATCATGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119} {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!