ID: 1007020853_1007020859

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1007020853 1007020859
Species Human (GRCh38) Human (GRCh38)
Location 6:38519772-38519794 6:38519823-38519845
Sequence CCTAGCTGCATCCCTGCCATTTC TTTGCACCTAAGCTAGATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 314} {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!