ID: 1007065698_1007065703

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1007065698 1007065703
Species Human (GRCh38) Human (GRCh38)
Location 6:38988287-38988309 6:38988323-38988345
Sequence CCCAAATAGCCTCCAAATTTGGT TTGTATGTGTATAAAGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 227} {0: 1, 1: 0, 2: 2, 3: 28, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!