ID: 1007065699_1007065703

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007065699 1007065703
Species Human (GRCh38) Human (GRCh38)
Location 6:38988288-38988310 6:38988323-38988345
Sequence CCAAATAGCCTCCAAATTTGGTG TTGTATGTGTATAAAGTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 28, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!