ID: 1007079062_1007079071

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1007079062 1007079071
Species Human (GRCh38) Human (GRCh38)
Location 6:39085985-39086007 6:39086008-39086030
Sequence CCCTCAAGTGTCCCACCAGCAGC CTGAGCAGTGGAGCCACGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 161} {0: 1, 1: 1, 2: 0, 3: 19, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!