ID: 1007093787_1007093795

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1007093787 1007093795
Species Human (GRCh38) Human (GRCh38)
Location 6:39200914-39200936 6:39200928-39200950
Sequence CCACCTTCAGACATGGGCAGGCA GGGCAGGCAGGGCAAGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182} {0: 1, 1: 0, 2: 19, 3: 124, 4: 1050}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!