ID: 1007094594_1007094607

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1007094594 1007094607
Species Human (GRCh38) Human (GRCh38)
Location 6:39205496-39205518 6:39205546-39205568
Sequence CCCTGCCCAGGGTGGCTATGGCC CTGCCCTATCTGGGACACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!