|
Left Crispr |
Right Crispr |
Crispr ID |
1007109760 |
1007109769 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:39306292-39306314
|
6:39306330-39306352
|
Sequence |
CCTTGGCCTACCAAAGTGCTGGG |
CACCGCACCCGGCCTGGGACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 434, 1: 83503, 2: 207090, 3: 234927, 4: 154556} |
{0: 1, 1: 6, 2: 40, 3: 209, 4: 855} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|