|
Left Crispr |
Right Crispr |
| Crispr ID |
1007109762 |
1007109769 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:39306298-39306320
|
6:39306330-39306352
|
| Sequence |
CCTACCAAAGTGCTGGGATTACA |
CACCGCACCCGGCCTGGGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1441, 1: 300795, 2: 267272, 3: 151222, 4: 133181} |
{0: 1, 1: 6, 2: 40, 3: 209, 4: 855} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|