ID: 1007142401_1007142403

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1007142401 1007142403
Species Human (GRCh38) Human (GRCh38)
Location 6:39588996-39589018 6:39589012-39589034
Sequence CCCTAATACACTTAGCATAATAT ATAATATCCCAGCTCCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 101, 4: 463} {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!