ID: 1007175824_1007175836

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1007175824 1007175836
Species Human (GRCh38) Human (GRCh38)
Location 6:39896777-39896799 6:39896816-39896838
Sequence CCATGCAGGCCTCTGACCTGTGC CCTGTTGGCCTCCCGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 448} {0: 1, 1: 0, 2: 2, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!