ID: 1007176803_1007176806

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1007176803 1007176806
Species Human (GRCh38) Human (GRCh38)
Location 6:39902737-39902759 6:39902757-39902779
Sequence CCATCCTGTCTACTAATCCACAG CAGTCCTAGAAGACTCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 135} {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!