|
Left Crispr |
Right Crispr |
Crispr ID |
1007179969 |
1007179984 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:39922919-39922941
|
6:39922969-39922991
|
Sequence |
CCCTCCTTCCTCCACCAGCACCC |
GCTCTGAAGCAGCTCCTCTGGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 1, 1: 0, 2: 7, 3: 26, 4: 255} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|