ID: 1007179977_1007179987

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1007179977 1007179987
Species Human (GRCh38) Human (GRCh38)
Location 6:39922940-39922962 6:39922993-39923015
Sequence CCATCTGCCCTGCCCTTCAAGGC AGATCAGAGGCTAGCCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 458} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!