ID: 1007229228_1007229239

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1007229228 1007229239
Species Human (GRCh38) Human (GRCh38)
Location 6:40336819-40336841 6:40336868-40336890
Sequence CCTCTGGCATGGGAGGTCAGTGA CAGAGCAACCAGAAGGATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 50, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!