ID: 1007230079_1007230087

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1007230079 1007230087
Species Human (GRCh38) Human (GRCh38)
Location 6:40342193-40342215 6:40342237-40342259
Sequence CCCACCTCGGAGAATGGGTTTAG GTACAATTCTGGGCTTATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!