ID: 1007238166_1007238173

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1007238166 1007238173
Species Human (GRCh38) Human (GRCh38)
Location 6:40405926-40405948 6:40405977-40405999
Sequence CCTGACTTGGGAGGCATGGCAGA GTCGCAGCCCAAGTGTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!