ID: 1007239343_1007239346

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1007239343 1007239346
Species Human (GRCh38) Human (GRCh38)
Location 6:40413880-40413902 6:40413893-40413915
Sequence CCCTCATGGTGGTTCTGAGTGCC TCTGAGTGCCAGTAGGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 151} {0: 1, 1: 1, 2: 0, 3: 11, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!