ID: 1007239828_1007239834

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1007239828 1007239834
Species Human (GRCh38) Human (GRCh38)
Location 6:40416928-40416950 6:40416954-40416976
Sequence CCTGTTCTAGTCAGGGTGGGGAA TAGGGCTTGGGTCTAAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!