ID: 1007239896_1007239903

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1007239896 1007239903
Species Human (GRCh38) Human (GRCh38)
Location 6:40417298-40417320 6:40417331-40417353
Sequence CCTGTCTCCATGCTCAGTGCCTC CGACCTGTCCACGCACACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 415} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!