ID: 1007244271_1007244275

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1007244271 1007244275
Species Human (GRCh38) Human (GRCh38)
Location 6:40448882-40448904 6:40448912-40448934
Sequence CCTGTTTTGCCAAAGGAAGGAAG AGTTTCCTTCTTTAGTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 259} {0: 1, 1: 0, 2: 0, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!