ID: 1007251416_1007251431

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1007251416 1007251431
Species Human (GRCh38) Human (GRCh38)
Location 6:40497728-40497750 6:40497773-40497795
Sequence CCTCTCCAACTCCCCCACCCTCA GATGCATGGCCTTTGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 153, 4: 1606} {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!