ID: 1007251422_1007251438

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1007251422 1007251438
Species Human (GRCh38) Human (GRCh38)
Location 6:40497745-40497767 6:40497798-40497820
Sequence CCCTCACCTTCCTGTCTTCCCCA CTTGGGCTCCCCAGGAAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 28, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!