ID: 1007257845_1007257847

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1007257845 1007257847
Species Human (GRCh38) Human (GRCh38)
Location 6:40541157-40541179 6:40541170-40541192
Sequence CCAGCCATCAGCGGGTCCCAGGC GGTCCCAGGCTCACAGTGAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!