ID: 1007296562_1007296564

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1007296562 1007296564
Species Human (GRCh38) Human (GRCh38)
Location 6:40826740-40826762 6:40826774-40826796
Sequence CCCTTCTTTTGCATTGGCTGAAC GAATTCTATAAACTCCTTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!