|
Left Crispr |
Right Crispr |
| Crispr ID |
1007326610 |
1007326617 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:41066229-41066251
|
6:41066248-41066270
|
| Sequence |
CCATCCTCCCGCCTCAACCTCTA |
TCTAGAGTAGCTGGAACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 78, 3: 1312, 4: 13448} |
{0: 17, 1: 724, 2: 14942, 3: 136752, 4: 261265} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|