ID: 1007330144_1007330164

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1007330144 1007330164
Species Human (GRCh38) Human (GRCh38)
Location 6:41100816-41100838 6:41100856-41100878
Sequence CCGCACCTCCAGCCCCTTCTCCC CTAAGAATGTGGGAAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 53, 3: 316, 4: 2307} {0: 1, 1: 0, 2: 0, 3: 43, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!