ID: 1007330147_1007330164

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007330147 1007330164
Species Human (GRCh38) Human (GRCh38)
Location 6:41100821-41100843 6:41100856-41100878
Sequence CCTCCAGCCCCTTCTCCCCGGGG CTAAGAATGTGGGAAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 87, 4: 730} {0: 1, 1: 0, 2: 0, 3: 43, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!