ID: 1007345102_1007345106

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1007345102 1007345106
Species Human (GRCh38) Human (GRCh38)
Location 6:41223199-41223221 6:41223223-41223245
Sequence CCCCAAGAGGGAGACATGAGGGT GTCCTCAGAAATCACAGTGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 27, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!