ID: 1007374629_1007374635

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1007374629 1007374635
Species Human (GRCh38) Human (GRCh38)
Location 6:41447995-41448017 6:41448017-41448039
Sequence CCAGCCTTCAAGCAACTCCATTC CCAGCTACTACCTGGGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!