ID: 1007396852_1007396855

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1007396852 1007396855
Species Human (GRCh38) Human (GRCh38)
Location 6:41582884-41582906 6:41582902-41582924
Sequence CCTGCGGTGGGGCAGGCAGCATA GCATAGGATGTGAAAACCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!