ID: 1007415932_1007415938

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1007415932 1007415938
Species Human (GRCh38) Human (GRCh38)
Location 6:41691222-41691244 6:41691237-41691259
Sequence CCGGCGCTGGCTCCCTGTGGATG TGTGGATGAGAAGGGGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 226} {0: 1, 1: 0, 2: 2, 3: 52, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!