ID: 1007430747_1007430755

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1007430747 1007430755
Species Human (GRCh38) Human (GRCh38)
Location 6:41775383-41775405 6:41775401-41775423
Sequence CCCCTATCCCAGGGTGGAGCAGG GCAGGGCCTGGTACTCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 237} {0: 1, 1: 0, 2: 7, 3: 38, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!