ID: 1007432752_1007432765

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1007432752 1007432765
Species Human (GRCh38) Human (GRCh38)
Location 6:41786248-41786270 6:41786292-41786314
Sequence CCCTGCTGCCCCAGCTGCTTCGA CTCGAGCTGGGCCGGGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 271} {0: 1, 1: 0, 2: 1, 3: 17, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!