ID: 1007432828_1007432839

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1007432828 1007432839
Species Human (GRCh38) Human (GRCh38)
Location 6:41786492-41786514 6:41786530-41786552
Sequence CCGCGCATCCCTGGCCGGAGCGT AACCCACCCCGCGCCGCGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!