ID: 1007452431_1007452438

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007452431 1007452438
Species Human (GRCh38) Human (GRCh38)
Location 6:41950443-41950465 6:41950478-41950500
Sequence CCTGGGCAGTTTACTTAACTTTT TCTCATTTGCAAAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 100, 4: 628} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!