ID: 1007453859_1007453864

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1007453859 1007453864
Species Human (GRCh38) Human (GRCh38)
Location 6:41961146-41961168 6:41961171-41961193
Sequence CCCTGTCAAACAATCCCAGCAAT CTTCATCAAAACAATCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!