ID: 1007459830_1007459835

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1007459830 1007459835
Species Human (GRCh38) Human (GRCh38)
Location 6:42009989-42010011 6:42010022-42010044
Sequence CCTCCAAGGAATGCAGGCTAAGC TTTGTTCTAGAATGTGGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 115} {0: 1, 1: 0, 2: 1, 3: 34, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!