ID: 1007468686_1007468691

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1007468686 1007468691
Species Human (GRCh38) Human (GRCh38)
Location 6:42073934-42073956 6:42073962-42073984
Sequence CCTGAATTTTGAAGGTAAGTCCA CTGTGCTAACAGATTGGGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!